Membrane-tethering of cytochrome c accelerates regulated cell death in yeast


Construction of membrane-anchored cytochrome c

The CYC1 gene from Saccharomyces cerevisiae, with its own promoter and terminator sequences, was synthesized by GeneArt® Gene Synthesis (Thermo Fischer Scientific) and was provided in a pRS305 vector. The mitochondrial targeting segment and the transmembrane sequence from the yeast CYB2 (lactate dehydrogenase) gene were inserted upstream of the CYC1 coding sequence. Thereby, the transmembrane segment of Cyb2 served as membrane-anchoring part for cytochrome c. In addition, the linker sequence from the membrane-anchored cytochrome c-y of Rhodobacter sphaeroides31, was inserted upstream of the CYC1 gene, which confers flexibility to the membrane-anchored cytochrome c in yeast.

This construct encoding the membrane-anchored form of cytochrome c (Cyc1MA, coding sequence of the whole construct is given in Table 1) was PCR-amplified (primer sequences: 5′- CTGTATGTATATAAAACTCTTGTTTTCTTC -3′ and 5′- AAAAATAAATAGGG ACCTAGACTTCAGGTTGTCTAACTCC -3′), and transformed into a yeast strain (obtained from Euroscarf), lacking both forms of cytochrome c (BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 cyc1cyc7∆)), where it was chromosomally integrated via homologous recombination. In this way, Cyc1MA resides in the open reading frame of the autonomous CYC1 gene, under the control of the endogenous CYC1 promoter.

Table 1 Coding sequence of the membrane-anchored cytochrome c variant (Cyc1MA).

Media and culturing conditions

Cells were grown at 28 °C and 145 rpm in synthetic complete (SC) medium, containing 0.17% yeast nitrogen base (Difco, BD Biosciences), 0.5% (NH4)2SO4, 30 mg/l of all amino acids (except 80 mg/l histidine and 200 mg/l leucine), 30 mg/l adenine and 320 mg/l uracil with 2% d-glucose. Full media (YEPD) agar plates contained 1% yeast extract (Bacto, BD Biosciences), 2% peptone (Bacto, BD Biosciences), 4% D-glucose and 2% agar. All media were prepared with double-distilled water and were autoclaved for 25 min at 121 °C, 210 kPa. Amino acids were prepared as 10x stocks, separately sterilized and added to the media after autoclaving.

Overnight cultures were grown for 16–20 h in SC medium using glass eprouvettes and were applied for inoculation of 10 ml SC medium in baffled 100 ml Erlenmeyer flasks to an OD600 of 0.3. After 6 h of incubation, cells were used for experiments. Treatments with antimycin A were performed in Erlenmeyer flasks. Therefore, antimycin A was dissolved in ethanol and added to cells after 24 h with a final concentration of 50 µM. Equivalent amounts of ethanol were added to control cells. For acetic acid treatment, cells were transferred into 96-well deep-well plates (500 µl of culture per well) and acetic acid was added to a final concentration of 120 or 160 mM. Strains were incubated for 1 h at 28 °C, 1000 rpm and subsequently applied for further analysis.

Analysis of cellular growth

Growth was analyzed with a Bioscreen CTM automated microbiology growth curve analysis system (Growth Curves USA). Cells were inoculated to an OD600 of 0.1 in SC media with indicated carbon sources in the suppliers “honeycomb microplate” in a final volume of 250 µl media per well and OD600 was measured automatically every 30 min at 28 °C and shaking on maximum level. Respective media without cells was used as blank. The doubling time was calculated from growth curves during logarithmic growth phase.

Analysis of cell death

Loss of membrane integrity as a marker of necrotic cell death was determined via propidium iodide (PI) staining as described previously32. In brief, ~2 × 106 cells were collected by centrifugation in 96-well plates and resuspended in 250 µl phosphate buffered saline (PBS, 25 mM potassium phosphate; 0.9% NaCl; adjusted to pH 7.2) containing 100 µg/l PI. After incubation for 10 min at room temperature (RT) in the dark, cells were washed once in PBS and 30,000 cells per sample were analysed via flow cytometry (BD LSR Fortessa; BD FACSDivia software).

For discrimination between necrotic and early/late apoptotic cell death phenotypes, AnnexinV/PI co-staining was performed according to refs. 11,33. Therefore, ~2 × 107 cells were harvested, washed once in digestion buffer (35 mM K3PO4, 0.5 mM MgCl2, 1.2 M sorbitol; adjusted to pH 6.8) and resuspended in 330 µl of the same buffer containing 2.5 µl Lyticase (1000 U/ml) and 15 µl Glucoronidase/Arylsulfatase (4.5 U/ml). Spheroplastation was conducted at 28 °C and 145 rpm and digestion of the cell wall was monitored microscopically (~0.5 h). Spheroplasts were carefully washed once in 500 µl digestion buffer and subsequently resuspended in 30 µl staining buffer (10 mM HEPES, 140 mM NaCl, 5 mM CaCl2, 0.6 M sorbitol; adjusted to pH 7.4) containing 100 µg/l PI and 2 µl Annexin-V-FLUOS reagent (Roche). After 20 min incubation at RT in the dark, 100 µl staining buffer was added per sample and transferred into 96-well plates for subsequent analysis via flow cytometry.

Clonogenic survival was evaluated as described recently33. In aggregate, the number of cells in culture was quantified via a CASY cell counting device (Schärfe Systems) and 500 cells were plated on YEPD agar plates. After 2 days incubation at 28 °C colony-forming units were counted.

Measurement of oxidative stress and mitochondrial transmembrane potential

To monitor oxidative stress, the reactive oxygen species (ROS)-driven conversion of non-fluorescent dihydroethidium (DHE) to fluorescent ethidium (Eth) was quantified with flow cytometry and visualized with confocal laser scanning microscopy, adapted from ref. 33. To that end, ~2 × 106 cells were harvested in 96-well plates, resuspended in 250 µl PBS containing 2.5 mg/l DHE and incubated for 10 min at RT in the dark. Afterwards, cells were washed and analysed as described for PI staining above.

To investigate mitochondrial transmembrane potential (Δψm), the protocol described in ref. 33 was slightly adapted. ~2 × 106 cells were resuspended in 250 µl PBS containing 5% glucose and 200 nM Mitotracker CMXRos. Cells were incubated, washed and analysed as described for DHE staining above.

Microscopy

Specimen were prepared on agar slides to immobilize yeast cells and investigated with a Leica SP5 confocal laser scanning microscope, equipped with a Leica HCX PL Apo 63× NA 1.4 oil immersion objective. Z-stacks were acquired using 64 × 64 × 12.6 (x/y/z) nm sampling and analysed as well as processed with the open-source software Fiji34. To that end, three-dimensional Gaussian filtering (xσ = yσ = zσ = 1), followed by background subtraction (rolling ball radius = 50 pixels) was applied and pictures were illustrated using the maximum-intensity projection method. Volume rendering to visualize mitochondrial morphology (“Projection” in Fig. 2b, d and f) was applied with the build-in Fiji Macro “Volume Viewer” by Kai Uwe Barthel (Mode: Volume; Interpolation: Trillinear; Sampling: 1.0). For micrographs presented in Fig. 3g, samples were prepared on agar slides and analysed with a Leica DM6B epifluorescence microscope, using a HC PL Apo 100× NA 1.4 oil immersion objective. The dynamic range of presented figures was adapted by using the “Brightness/contrast” tool of Fiji. All pictures within an experiment were captured and processed with the same settings.

Measurement of cellular oxygen consumption

Oxygen consumption of yeast was quantified with a Fire-Sting optical oxygen sensor system (Pyro Science) as described previously33. In brief, 2 ml of culture were transferred into glass tubes, hermetically sealed and directly used for analysis. Oxygen concentration was measured for 1 min and the slope of the regression line was calculated and normalized to the number of PI negative (and thus viable) cells in the glass tube (evaluated by CASY cell counting and quantification of PI negative cells with flow cytometry as described above). Oxygen consumption per living cells is expressed as fold value normalized to wild type cells.

Isolation of mitochondria

Isolation of mitochondria from yeast cells was performed as described in ref. 35. In brief, cells grown to mid-logarithmic phase were harvested by centrifugation and resuspended in 2 ml/g cell wet weight MP1 buffer (0.1 M Tris-H2SO4, 10 mM dithiothreitol; adjusted to pH 9.4). After incubation for 10 min at 30 °C, samples were washed in 1.2 M sorbitol and resuspended in MP2 buffer (20 mM potassium phosphate, 0.6 M sorbitol; adjusted to pH 7.4), containing 3 mg/g of cell wet weight zymolyase 20 T. Spheroplasts were created by incubation for 1 h at 30 °C and harvested by centrifugation. Samples were carefully resuspended in 13.4 ml/g of cell wet weight in homogenization buffer (10 mM Tris, 0.6 M sorbitol, 1 mM EDTA, 1 mM PMSF; adjusted pH 7.4) and homogenized by 10 strokes with a Teflon plunger (Sartorius Stedim Biotech S.A.). Homogenates were centrifuged at 3000 g for 5 min at 4 °C and the resulting supernatants were subsequently centrifuged at 17,000 g for 12 min at 4 °C. Pelleted mitochondria were resuspended in isotonic buffer (20 mM HEPES, 0.6 M sorbitol; adjusted to pH 7.4) to a concentration of 10 mg/ml.

Immunoblot analysis

To obtain whole-cell extracts, cells were harvested by centrifugation at 18,400 g for 2 min and resuspended in 50 µL of Laemmli buffer (63 mM Tris, 2% SDS, 10% glycerol, 0.1% β-mercaptoethanol and 0.0005% bromophenol blue; adjusted to pH 6.8). Samples were boiled for 3 min at 95 °C and 10 µl were applied for SDS-PAGE and immunoblotting following standard protocols.

For submitochondrial fractionation experiments, 100 µg of mitochondrial protein were treated with 0.2 M NaCl and five freeze-and-thaw cycles in liquid nitrogen were performed. After centrifugation at 100,000×g for 30 min at 4 °C, supernatants and pellet fractions were treated with trichloroacetic acid (12% final concentration) to precipitate proteins. Samples were incubated for 20 min at −20 °C and afterwards centrifuged at 28,000×g for 30 min at 4 °C. Pellet fractions were washed with acetone, followed by additional centrifugation at 28,000 rcf for 15 min at 4 °C. Of note, samples for total protein were left untreated. Finally, samples were boiled at 95 °C for 3 min, resuspended in Laemmli buffer and 10 µl of the samples were applied for SDS-PAGE and immunoblotting following standard protocols. Blots were probed with antibodies against cytochrome c (holo form), Tom70, Mdh1 and Aco1 as loading control, which were kindly provided by Nora Vögtle, University of Freiburg. Peroxidase-conjugated secondary anti-rabbit antibodies (BioRad, 1705046 and Sigma, A0545) were used for chemiluminescence detection.

Blue native electrophoresis

Isolated mitochondria were centrifuged at 16,000 g for 10 min at 4 °C and the pellet was subsequently resuspended in lysis buffer (50 mM Bis-Tris, 25 mM KCl, 2 mM Aminohexanoic acid, 12% glycerol, 1 mM PMSF, 2% digitonin and Complete Protease Inhibitor cocktail (Roche). 100 µg of mitochondrial protein was loaded on a 3–12% precast native gel (Invitrogen), which was subsequently stained with Coomassie.

UV-VIS spectroscopy

Optical spectra (350–700 nm) were recorded using Cary4000 UV-Vis spectrophotometer (Agilent Technologies). The concentration of a-type hemes was determined from the sodium dithionite-reduced minus potassium ferricyanide-oxidized difference spectra using the absorption coefficient ε (630–605 nm) = 23.2 mM−136. Concentrations of b– and c-type hemes were measured simultaneously from difference spectra as described in ref. 37, using the following formula:

[heme b] (mM) = (Δ(A562 − A577) × 3.539 × 10–2 − Δ(A553 − A540)) × 1.713 × 10–3

[heme c] (mM) = (Δ(A553 − A540) × 5.365 × 10–2 − Δ(A562 − A577)) × 9.564 × 10–3

Measurement of oxygen reduction rate in isolated mitochondria

Isolated mitochondria were resuspended in HEPES buffer (20 mM HEPES, 250 mM sucrose, 50 mM KCl, 0.1 mM EDTA; adjusted to pH 7.4). Cytochrome c oxidase activity (the oxygen reduction rate) was monitored using a Clark-type oxygen electrode (Hansatech) with 1 ml chamber volume. 10 µM antimycin A (cytochrome bc1 inhibitor) and 0.5 µM FCCP (Carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone, uncoupling agent) were added to the reaction chamber. Sodium ascorbate (5 mM) was used as electron donor, 0.5 mM TMPD (N,N,N′,N′-Tetramethyl-p-Phenylenediamine) as electron mediator. Addition of mitochondria (at a final concentration in the range of 2–5 nM cytochrome c oxidase) started the reaction. Coupled cytochrome bc1 / cytochrome c oxidase activity was measured upon addition of 0.12 mM decylhydroquinone (DBH2) as electron donor. Baseline oxygen-consumption (auto-oxidation of DBH2) was recorded before addition of the mitochondria. Oxygen consumption was blocked by addition of KCN, verifying that the observed oxygen reduction was due to the activity of cytochrome c oxidase. Mitochondria devoid of the mitochondrial outer membrane (OMM) were prepared as described above. Where needed, 5 µM yeast cytochrome c (Sigma, C2436) was added to the mixture before addition of DBH2. Decylubiquinone (Sigma, D7911) was reduced to DBH2 by addition of a small crystal of potassium borohydride to 50 µl of 60 mM decylubiquinone in DMSO. 5 µl aliquots of 0.1 M HCI were added with gentle mixing until the yellow solution became colorless. DBH2 was transferred to a fresh tube, avoiding borohydride crystals. Final DBH2 concentration was determined from the A277 nm using ε277 = 16 mM−1. Coupled activity values were normalized to the concentration of cytochrome c oxidase (a-type heme).

Statistics and data representation

Results are presented as line graphs or bar charts, indicating mean ± standard error of the mean (s.e.m.), or dot plots with mean (square) ± s.e.m. and median (centre line), as well as single data points. Exact sample sizes are given in the figure legends and represent biological replicates, except for Fig. 4e, where technical replicates were used. The sample size was thereby chosen according to empirical values that are standard in the field. Visualized data were taken from representative experiments that were replicated at least two times. Randomization was not performed in our study and investigators were not blinded. Outliers were identified using the 2.2-fold interquartile range labelling rule (outlier data points are highlighted in turquoise) and data was transformed upon the presence of outliers (detailed description of the method used in Supplementary Table 1; no data was excluded from the analysis). Normality of data was evaluated with a Shapiro–Wilk’s test and homogeneity of variances was examined with a Levene’s test (both analysed with Origin Pro 2018). A detailed description of the procedure upon violation of respective assumptions is given Supplementary Table 1. In brief, means of two groups were compared with a two-sample t-Test (with Welch correction upon the presence of significantly different variances). The means of three or more groups were compared upon the presence of one independent variable (genotype) with a One-way Analysis of Variance (ANOVA) followed by a Bonferroni post hoc test (calculated with Origin Pro 2018) or a Welch’s ANOVA with a Games-Howell post hoc test in case of significantly heterogenous variances (analysed with IBM SPSS Statistics, Version 25). To compare the means of groups upon the presence of two independent variables (genotype and treatment), a two-way ANOVA followed by a Bonferroni post hoc test was conducted with Origin Pro 2018. Analysis of cell death over time was statistically evaluated with a two-way ANOVA mixed design (strain as between-subject and time as within-subject factor) with a Bonferroni post hoc test using Origin Pro 2018. Significances for analyses with one independent variable are indicated with asterisks (***P < 0.001, **P < 0.01, *P < 0.05, n.s. P > 0.05), and for two independent variables main effects are displayed with diamonds (###P < 0.001, ##P < 0.01, #P < 0.05, n.s. P > 0.05), simple main effects are depicted as asterisks (***P < 0.001, **P < 0.01, *P < 0.05, n.s. P > 0.05). Calculated p-values are presented in Supplementary Table 1. All figures were created with Origin Pro 2018 and further processed with Adobe Illustrator CS6.



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *