SARS-CoV-2 Nsp1 binds the ribosomal mRNA channel to inhibit translation


Cell lines

For the puromycilation experiments, HeLa (ATCC; CCL2) cells were used and tested negative for mycoplasma. HeLa cells were cultured in DMEM supplemented with 10% FCS supplemented with 100 UI ml−1 penicillin and 100 μg ml−1 streptomycin (DMEM+/+) at 37 °C, 5% CO2. For generation of the HEK lysate, 293 c18 (ATCC CRL-10852), a human HEK293-EBNA cell line, was used, and cells were tested negative for mycoplasma.

Cloning, expression and purification of Nsp1 in E. coli

Plasmids encoding the WT Nsp1 sequence and the N-terminal domain replaced by the soluble domain of E. coli thioredoxin were ordered from GenScript Biotech. Plasmids encoding Nsp1 protein mutants were generated by site-directed mutagenesis using the primers 5′-GTT CAC GGG TCA CAC CGC TGC TAG CTG CGG TAT TCC AAT TTT CCT GAA AAT-3′, 5′-CGA GTT AGC CAC CAT TCA GTT CCT CCA TCA GTT CCT CGG TCA CAC CGC TGC TAT GTT TG-3′ and 5′-TTT GGT ATT CCA ATT TTC CTG AGC ATC TTC AGC CGG ATC GGT GCC CAG TTC ATC G-3′ to yield KHAA, RREE and YFAA mutants, respectively. Nsp1 (WT and mutants) carrying an N-terminal His6-tag followed by a tobacco etch virus (TEV) cleavage site was expressed from a pET24a vector. The plasmid was transformed into E. coli BL21-CodonPlus (DE3)-RIPL and cells were grown in 2× YT medium at 30 °C. At an optical density at 600 nm (OD600) of 0.8, cultures were shifted to 18 °C and induced with IPTG added to a final concentration of 0.5 mM. After 16 h, cells were collected by centrifugation, resuspended in lysis buffer (50 mM HEPES-KOH pH 7.6, 500 mM KCl, 5 mM MgCl2, 40 mM imidazole, 10% (wt/vol) glycerol, 0.5 mM TCEP and protease inhibitors) and lysed using a cell disrupter (Constant Systems). The lysate was cleared by centrifugation for 45 min at 48.000g and loaded onto a HisTrap FF 5-ml column (GE Healthcare). Eluted proteins were incubated with TEV protease at 4 °C overnight and both the His6-tag, uncleaved Nsp1 and the His6-tagged TEV protease were removed on the HisTrap FF 5-ml column. The sample was further purified via size-exclusion chromatography on a HiLoad 16/60 Superdex75 system (GE Healthcare), buffer exchanging the sample to the storage buffer (40 mM HEPES-KOH pH 7.6, 200 mM KCl, 40 mM MgCl2, 10% (wt/vol) glycerol, 1 mM TCEP). Fractions containing Nsp1 were pooled, concentrated in an Amicon Ultra-15 centrifugal filter (10-kDa molecular weight cutoff (MWCO)), flash-frozen in liquid nitrogen and stored until further use at −80 °C.

Preparation of human ribosomal subunits

Human ribosomal subunits were purified as described in ref. 25 and the final samples were flash-frozen in liquid nitrogen at a concentration of 1 mg ml−1 (OD600 of 10) and stored at −80 °C.

Sucrose pelleting binding assay

To verify Nsp1–40S complex formation, we performed binding assays using sucrose density centrifugation. Thawed human 40S and 60S ribosomal subunits were adjusted to a final concentration of 0.3 μM in a 100 μl reaction (complex binding buffer: 20 mM HEPES pH 7.6, 5 mM MgCl2, 100 mM KCl, 2 mM DTT) and mixed with a 5× molar excess of His6-Nsp1 WT/mutant. The assembled complexes were incubated for 5 min at 30 °C and for 10 min on ice before they were loaded on a 30% (wt/vol) sucrose cushion in TLA-100 tubes (Beckman Coulter). The sucrose cushions were centrifuged for 2 h at 390,880g and 4 °C. After removing the supernatant, the pellet was resuspended in 20 μl of complex binding buffer. Samples were analyzed on bleach agarose gels (0.06% bleach, 1% (wt/vol) agarose) for visualization of the RNA and on western blot (anti-His antibody, Clontech) for visualization of His6-tagged Nsp1.

Preparation of viral 5′-UTR mRNA and reporter RLuc mRNA

Plasmids

MS2-containing mRNA reporters (p200-6xMS2) were derived from the pCRII-hRLuc-200bp 3′ UTR construct as described previously14. Amplification of the vector using the primers 5′-AAT AAG AGC TCC TGC CTC GAG CTT CCT CATC-3′ and 5′-AAT AAC ATA TGG TGA TGC TAT TGC TTT ATT TGT AAC-3′ was followed by restriction digestion with SacI and NdeI and ligation with a 6xMS2-containing insert that was PCR-amplified using the primers 5′-AAT AAC ATA TGG TTC CCT AAG TCC AAC TAC CAA A-3′ and 5′-AAT AAA GAG CTC CCA GAG GTT GAT TGT CGA CC-3′ and that had been treated with the same enzymes. The 265-nt-long 5′ UTR of SARS-CoV genomic mRNA sequence was subcloned to replace the RLuc 5′ UTR by fusion PCR using primers TCTGCAGAATTCGCCCTTCATG and GCCCTATAGTGAGTCGTATTACAATTCACT for vector amplification and the pair GACTCACTATAGGGCAACTTTAAAATCTGTGTGGCTGTCACT and GGCGAATTCTGCAGACTTACCTTTCGGTCACACCCG for amplification of the 5′ UTR fragment using 5′ UTR-eGFP cloned in pUC19 vector as a template, which was designed to possess the SARS-CoV-2 5′ UTR sequence in front of the eGFP coding sequence.

In vitro transcription of reporter mRNAs

Preparation of in vitro transcribed mRNAs was performed as described in ref. 14; namely, linearized pCRII vectors encoding the desired reporter mRNA downstream of a T7 promoter were mixed to yield an in vitro transcription reaction in 1× transcription buffer (Thermo Fisher Scientific) at a final concentration of 20–30 ng µl−1. This mixture further contained each ribonucleotide at 1 mM (rNTPs, Thermo Fisher Scientific), 1 U µl−1 murine RNase inhibitor (Vazyme), 0.001 U µl−1 pyrophosphatase (Thermo Fisher Scientific) and 5% (vol/vol) T7-RNA-polymerase (custom-made). The reaction was incubated at 37 °C for 1 h and then an equal quantity of T7-RNA polymerase was added for another 30 min. The mixture was then supplemented with TURBO DNase (Thermo Fisher Scientific) to a final concentration of 0.14 U µl−1 and incubated at 37 °C for 30 min. The transcribed mRNA was purified from the reaction using an acidic phenol-chloroform-isoamylalcohol (PCI). The product was dissolved in disodium citrate buffer, pH 6.5, and quality was assessed by agarose gel electrophoresis.

Before capping, the RNA was incubated at 65 °C for 5 min and supplemented accordingly to yield a reaction consisting of 300 ng µl−1 RNA, 0.5 mM guanosine triphosphate (GTP, New England Biolabs), 0.1 mM S-adenosylmethionine (SAM, New England Biolabs), 1 U µl−1 murine RNase inhibitor (Vazyme), 0.5 U µl−1 vaccinia capping enzyme (New England Biolabs) in 1× capping buffer (New England Biolabs). The capping reaction was carried out at 37 °C for 1 h and quenched by the addition of acidic PCI, followed by RNA purification. Finally, the integrity of the capped mRNAs was verified by agarose gel electrophoresis.

Preparation of HeLa translation-competent lysates

HeLa S3 lysates were prepared similarly to the description in ref. 14. Briefly, lysates were prepared from S3 HeLa cell cultures grown to a cell density ranging from 1 × 106 to 2 × 106 cells per ml. Cells were pelleted (200g, 4 °C for 5 min) and washed twice with cold PBS pH 7.4 and finally resuspended in ice-cold hypotonic lysis buffer (10 mM HEPES pH 7.3, 10 mM K-acetate, 500 μM Mg-acetate, 5 mM DTT and 1× protease inhibitor cocktail (biotool.com)) at a final concentration of 2 × 108 cells per ml. The suspension was incubated on ice for 10 min and cells were lysed by dual centrifugation (500 r.p.m., −5 °C, 4 min) using Zentrimix 380 R system (Hettich) with a 3206 rotor and 3209 adapters. The lysis process was monitored by trypan staining. The lysate was centrifuged at 13,000g, 4 °C for 10 min and the supernatant was aliquoted, snap-frozen and stored at −80 °C.

In vitro translation assays

In vitro translation reactions were performed similarly to the description in ref. 14. Briefly, 400 μl of recombinant proteins were dialyzed overnight in 30 mM NaCl, 5 mM HEPES pH 7.3 at 4 °C using Slide-A-Lyzer MINI Dialysis devices with a 3.5k MWCO (Thermo Scientific, 88400), and the protein concentration was calculated using Nanodrop. In parallel, equal volumes of recombinant protein storage buffer were dialyzed and used as negative control (0 μM condition) and to maintain the same concentration of dialyzed storage buffer in translation mixtures. S3 lysate corresponding to 1.11 × 106 cell equivalents was used at a concentration of 8.88 × 107 cell equivalents per ml. The reaction was supplemented to a final concentration of 15 mM HEPES, pH 7.3, 0.3 mM MgCl2, 24 mM KCl, 28 mM K-acetate, 6 mM creatine phosphate (Roche), 102 ng µl−1 creatine kinase (Roche), 0.4 mM amino acid mixture (Promega) and 1 U µl−1 NxGen RNase inhibitor (Lucigen). Control reactions contained 320 µg ml−1 puromycin (Santa Cruz Biotechnology) and all reactions were complemented with an equal volume of dialyzed protein purification buffer. In all reactions where recombinant Nsp1 was used, the lysate was pre-incubated with Nsp1 at 4 °C for 30 min. Before addition of reporter mRNAs, the mixtures were incubated at 33 °C for 5 min. In vitro transcribed and capped mRNAs were incubated for 5 min at 65 °C, 15 min at room temperature (RT) and cooled on ice. Reporter mRNAs were added to the translation reactions at a final concentration of 40 fmol μl−1. The translation reaction was performed at 33 °C for 50 min. To monitor the protein synthesis output, samples were put on ice and mixed with 50 μl 1× Renilla-Glo substrate (Promega) in Renilla-Glo (Promega) assay buffer on a white-bottomed 96-well plate. The plate was incubated at 30 °C for 10 min and the luminescence signal was measured three times using the TECAN infinite M100 Pro plate reader and plotted on GraphPad after performing three independent biological replicates.

Transient expression of FLAG-Nsp1 in HeLa cells and puromycin incorporation assay

The plasmid encoding the N-terminally tagged WT Nsp1 DNA sequence (pcDNA3.1(+) backbone) was ordered from GeneScript and the mutant K164A/H165A (KH) construct was created by site-directed mutagenesis using the primer 5′-GTT CCC TTG TCA CGC CGC TAC TAG CTG CGG TAT TCC AAT TCT CCT GAA AAT-3′.

HeLa cells were cultured in DMEM supplemented with 10% FCS supplemented with 100 UI ml−1 penicillin and 100 μg ml−1 streptomycin (DMEM+/+) at 37 °C, 5% CO2. To compare expression levels of different FLAG-Nsp1 protein variants (WT/KH), ~4 × 105 cells were transfected with 400 ng of each plasmid using 7.5 μl μg−1 DNA Dogtor transfection reagent (Oz Biosciences) in Opti-MEM (Thermo Fisher Scientific). As a control, an equal amount of empty vector was added to the reaction. After 24 h the samples were collected by trypsinization, counted and lysed in RIPA buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1% SDS). The whole-cell extract was then isolated by centrifugation at 13,000g, 4 °C. Finally, the extracts were combined with an equal volume of 2× LDS sample buffer (Invitrogen) containing 100 mM DTT.

For the puromycin incorporation assay, ~1.25 × 105 cells were transfected with 500 ng of the WT FLAG-Nsp1 plasmid (or empty vector) and 100 ng of the FLAG-Nsp1 KH mutant plasmid (using Dogtor and Opti-MEM as above). After one day, the transfection was repeated with double the amount of plasmid DNA and the cells were incubated for 24 h again. Forty minutes before the end of this incubation time the medium was changed to DMEM+/+ containing 10 μg ml−1 puromycin (Santa Cruz Biotechnology) for 10 min to label newly synthesized proteins. Subsequently, the cells were washed with 1× PBS and the cells were recovered in the original medium for 30 min. Ultimately, the cells were collected as described above. In addition, a positive control condition for translation inhibition was included (empty vector transfected) in which the medium was supplemented with CHX (Focus Biomolecules) to 100 μg ml−1 within the last 2 h of the experiment (apart from the puromycin pulse).

From the prepared protein samples, 2 × 105 cell equivalents were resolved by SDS-PAGE (NuPAGE 4 to 12%, Bis-Tris, 1.0 mm, Midi Protein Gel, 12 + 2-well, Thermo Fisher) in MOPS buffer. For analysis of incorporated puromycin, an additional 1:2 dilution was loaded. Proteins were then blotted on a nitrocellulose membrane (iBlot 2, NC Regular Stacks, program P0), blocked and then probed with the following primary antibodies: mouse anti-puromycin (EMD Milllipore, cat. no. MABE343, used at 1:15,000), mouse anti-FLAG M2 (Sigma Aldrich, cat. no. F1804, used at 1:2,500) and rabbit anti-GAPDH (Santa Cruz Biotechnology, cat. no. sc-25778, used at 1:10,000). The signal on the anti-puromycin-stained blot was quantified using ImageJ 1.52p with the line selection tool to measure the whole lane intensity of the puromycin signal (manual background subtraction) and the gel analyzer tool to measure the intensity of the GAPDH loading control.

HEK extracts and sucrose gradient analysis

HEK293E cell lysates were supplemented with Nsp1 to purify native-like Nsp1-inhibited translation complexes. For this, frozen HEK293E cells were thawed and resuspended in 2× excess of lysis buffer (25 mM HEPES-KOH pH 7.6, 5 mM MgCl2, 50 mM KCl, cOmplete protease inhibitor cocktail (Roche), 1 mM PMSF, 0.2 U µl−1 RiboLock). For cell lysis, cells were transferred to a Dounce homogenizer (tight) and lysed with 12 strokes. After adding Triton X-100 to a final concentration of 0.1%, the lysate was incubated under rotation for 30 min at 4 °C and cleared for 10 min in an MLA-80 rotor (Beckman Coulter) at 11,500g and 4 °C. The cleared HEK293E lysate was supplemented with untagged Nsp1 (for cryo-EM) or His6-Nsp1 (for western blot) to a final concentration of 2 µM, and the extracts were incubated for an additional 5 min at 30 °C before they were loaded onto 15–45% (wt/vol) sucrose gradients (20 mM HEPES-KOH pH 7.6, 100 mM KOAc, 5 mM MgCl2, 1 mM DTT). Gradients were centrifuged in a SW 32.1 Ti rotor (Beckman) at 79,500g for 15 h at 4 °C and manually fractioned with a syringe. Fractions containing ribosomal particles were pooled and concentrated in an Amicon Ultra-15 centrifugal filter (100-kDa MWCO). For biochemical analyses, the same gradients were prepared, with the exception of using His6-tagged Nsp1 instead of the TEV-cleaved protein. Fractions were precipitated with trichloroacetic acid (TCA) and subjected to western blot analysis (anti-His antibody, Clontech). Additionally, before precipitation, samples were taken for analysis on agarose gels (0.06% bleach, 1% (wt/vol) agarose).

Cryo-electron microscopy sample preparation and data collection

Quantifoil R2/2 holey carbon copper grids (Quantifoil Micro Tool) were prepared by first applying an additional thin layer of continuous carbon and then glow-discharging them for 15 s at 15 mA using an easiGlow Discharge cleaning system (PELCO). For the in vitro binding experiment, purified Nsp1 was first mixed with 40S in a molar ratio of 10:1. For the HEK lysate sample, sucrose peak fractions containing ribosomes were collected, buffer exchanged and concentrated, then, 4-µl samples at concentrations of 80–100 nM of the 40S–Nsp1 or ribosomes from the HEK cell lysate were applied to the grids, which were then blotted for ~8 s and immediately plunged in 1:2 ethane:propane (Carbagas) at liquid nitrogen temperature using a Vitrobot sytem (Thermo Fisher Scientific). The Vitrobot chamber was kept at 4 °C and 100% humidity during the whole procedure.

For each sample, one grid was selected for data collection using a Titan Krios cryo-transmission electron microscope (Thermo Fisher Scientific) operating at 300 kV and equipped with a K3 camera (Gatan), which was run in counting and super-resolution mode, mounted to a GIF Quantum LS imaging filter operated with an energy filter slit width of 20 eV. The K3 datasets were collected at a nominal magnification of ×81,000 (physical pixel size of 1.08 Å per pixel, which corresponds to a super-resolution pixel size of 0.54 Å per pixel). For the counting mode, illumination conditions were adjusted to an exposure rate of 24 e pixel−1 s−1. Micrographs were recorded as video stacks at an electron dose of ~60 e Å−2 applied over 40 frames. For both datasets, the defocus was varied from ~−1 to −3 μm.

Cryo-electron microscopy data processing

The stacks of frames were first aligned to correct for motion during exposure, dose-weighted and gain-corrected using MotionCor2 (ref. 26). The super-resolution micrographs collected with the K3 camera were additionally binned twice during the MotionCor2 procedure. The contrast transfer functions of the motion-corrected and dose-weighted micrographs were then estimated using GCTF27.

Micrographs (10,104 for the in vitro binding experiment, 15,866 for the HEK cell extract) were carefully inspected based on CTF estimations for drift and ice quality. Particle images of ribosomes were picked (2,078,577 for the in vitro binding experiment, 1,358,638 for the HEK cell extract) in RELION3.1 using a Laplacian-of-Gaussian filter-based method28. The picked particle images were then subjected to a reference-free two-dimensional (2D) classification in RELION/cryoSPARC2, and the particles were selected from the 2D class averages (1,718,196 particles for the in vitro binding experiment, 1,113,915 for the HEK cell extract). For the in vitro binding experiment, the particles were then classified in 3D using a human 40S reinitiation complex (EMD 3770 (ref. 25)) that was low-pass-filtered to 60 Å to select for good 40S classes, followed by refinement using RELION3.1 (ref. 29). Further processing was done with RELION3.1 and cryoSPARC2 (ref. 30) according to the scheme shown in Extended Data Fig. 2. Transformation of particle information between the two programs was done using PyEM script (https://doi.org/10.5281/zenodo.3576630). In short, the particle set was first cleaned from the preferentially oriented particles based on their orientation parameters, which reduced the particle set to 700,459 particles. Those particles were then further classified for their quality and for the presence of Nsp1 using a focused 3D classification approach. The final set of particle images was refined using a global 3D refinement. To further improve the local resolution of the 40S–Nsp1 complex, masks around the 40S head and body were generated using UCSF Chimera31 by creating a mask that was extended by 10 Å around a fitted model of the 40S subunit. Those masks were used for a multi-body refinement in RELION3.1 (ref. 32). Finally, the two focused maps were combined to generate a composite 3D map of the entire in vitro reconstituted 40S–Nsp1 complex.

For the HEK cell extract, after 2D classifications, ab initio reconstruction was performed in cryoSPARC2 (ref. 30), and the determined volumes were used as starting references for a heterogeneous refinement in cryoSPARC2 (Extended Data Fig. 1). The 204,114 particle images corresponding to the 40S ribosomal subunit were selected for a further round of heterogeneous refinement in cryoSPARC2, which resolved a density corresponding to initiation factor eIF3 in a fraction of the particles. To improve the occupancy of eIF3, particle images belonging to the 40S subunit class were then subjected to a focused 3D classification in RELION3.1 using a circular mask on the eIF3 region. The 3D class depicting the best density for eIF3 was selected (18,692 particle images) and was then used for a global 3D refinement.

Structure building and refinement

For building of the 40S–Nsp1 complex, the head and body of PDB 5OA3 (ref. 25) were docked as rigid bodies into the 2.8-Å head and body maps that were obtained by focused classification (Extended Data Fig. 2). The structures were adjusted manually into the high-resolution maps using COOT33, and the C terminus of Nsp1 (residues 148–180), which was well-resolved in the map of the 40S body, was built de novo. The coordinates were subjected to five cycles of real-space refinement using PHENIX 1.18 (ref. 34). To stabilize the refinement in less well-resolved peripheral areas, protein secondary structure and Ramachandran as well as RNA base pair restraints were applied. Remaining discrepancies between models and maps as well as missing Mg2+ ions were detected using real-space difference maps and, after model completion, the coordinates were refined for two additional cycles. The resulting final models have excellent geometries and correlations between the maps and models (Table 1 and Extended Data Fig. 2). The structures were validated using MolProbity35 and by comparison of the model versus map FSCs at values of 0.5, which coincided well with the FSCs between the half-sets of the EM reconstruction using the FSC = 1.43 criterion (Extended Data Fig. 2).

To assemble the full 40S–Nsp1 complex, both refined structures were docked into a 2.8-Å chimeric map comprising the complete 40S–Nsp1. After readjustment of the head-to-body connections, the complete model was subjected to two additional rounds of real-space refinement as described above.

The 4.1-Å and 2.5-Å maps of the Nsp1–43S PIC and non-translating 80S shown in Extended Data Figs. 1 and 3 were aligned onto the 2.8-Å 40S–Nsp1 body map of the in vitro reconstituted complex in UCSF Chimera, into which the atomic model had been built. For general interpretation of 43S PIC and non-translating 80S, the refined models of the 40S head and body determined for the in vitro 40S–Nsp1 complex were docked as rigid bodies in UCSF Chimera31. To highlight the regions of the initiation factors in the cryo-EM map, initiation factors IF2 and IF3 were taken from PDB 6YAM36 and docked similarly. A homology model for the missing eIF2β subunit was obtained using PHYRE2 (ref. 37) and PDB 3JAP38 as a template, and the density of IF1 was interpreted using PDB 2IF1 (ref. 39).

Reporting Summary

Further information on experimental design is available in the Nature Research Reporting Summary linked to this Article.



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *