CIVIL ENGINEERING 365 ALL ABOUT CIVIL ENGINEERING


Aptamer structure and solution preparation

The GA binding ssDNA aptamer and the TNF-α binding ssDNA aptamer used in this study was purchased from Biosearch Technologies (Petaluma, CA, USA). The aptamers used in this study have been chosen based on literature review and previous studies conducted on them. The GA binding aptamer consists of 23 bases and has been modified on both ends with an amine group on the 5′ and a thiol group on the 3′ (5′Amino C6/TGCGGTTGTAGTACTCGTGGCCG/Thiol C6 SS 3′)2. The aptamer was dissolved into tris ethylenediamine tetraethyl acetate (EDTA) buffer to obtain 100 µM aptamer solution. This step was conducted in order to prevent cation induced degradation of DNA bases.

The TNF-α binding aptamer consists of 25 bases and has been modified on both ends with an amine group on the 5′ and a thiol group on the 3′ (5′AminoC6/TGGTGGATGGCGCAGTCGGCGACAA/Thiol C6 SS 3′)1. To obtain a 100 µM aptamer solution, the aptamer was dissolved into 887 μl of EDTA buffer.

Materials used for synthesis protocols

Synthesis of DSS peptide conjugated molecular beacon using GA binding aptamer

The synthesis protocol of the DSS conjugated molecular beacon with the GA binding aptamer is based on the protocol reported by Ghosh et al.2. Briefly, 9 μl of TCEP was added to 20 μl of the 100 μM GA aptamer and the mixture was allowed to incubate for 30 min at room temperature. This step facilitated the reduction of the dithiol groups in the aptamer. 100 μl of gold nanoparticle (diameter: 1.4 nm; Nanoprobes, USA)27 solution was synthesized by adding the same volume of de-ionized water to one vial of gold nanoparticles. This was further added to the aptamer-TCEP mixture in order to achieve a 3:1 ratio between the quencher and the aptamer. The resulting solution was then incubated for 2 h at room temperature. Subsequently, it was centrifuged twice at 5,000 rpm for 15 min each using a 3 k MWCO filter in order to remove the excess unbound gold nanoparticles from the solution. After each centrifugation, 50 μl of de-ionized water was used to wash the supernatant. The centrifuge used for all centrifugation steps was the Fisher Scientific Accuspin micro (Fisher Scientific, USA). A 100 μl QD solution was synthesized by mixing 87 μl of 10 mM borate buffer (pH 7.4) and 13 μl of carboxylated CdSe/ZnS QD (0.1 nmoles). The carboxylated CdSe/ZnS QDs (diameter: 20 nm) used in this protocol as well the other protocols, stated in the paper were obtained from Thermo Fisher Scientific (Qdot 655 ITK—8 μM solution—2 nmoles in 50 mM borate buffer)28 and the datasheets show a sharp emission spectrum centered at 655 nm with a half-width of 35 nm. Such a narrow emission spectrum is a general feature of high quality QDs since the dominant quantum mechanical emission probability is from the bottom of the conduction band to the top of the valence band. The gold nanoparticles used in these experiments have a wide absorption spectrum27 with the ability to absorb light between 300 and 800 nm. Therefore, they are effective at quenching fluorescence at 655 nm, which is the peak emission wavelength of the QD. Four different amounts of DSS peptide was added during four different synthesis experiments of the peptide conjugated sensor. The concentrations of the peptide are summarized in Table 1. EDC/NHS coupling chemistry was used to bind the QDs to the DNA aptamer as well as to bind the DSS peptide to the QD. 100 μl of the QD solution and 230 μl of DSS peptide solution (with the corresponding concentration mentioned in Table 1) was added to the filtered GA aptamer/gold nanoparticle solution in the presence of 30 μl of 4 μg/μl EDC/Sulpho NHS solution. The resulting solution was then allowed to shake for 2 h at room temperature. Subsequently, the samples were centrifuged five times at 7,000 rpm for 5 min each using a 100 k MWCO filter in 50 mM borate buffer (pH 8.3). The supernatant was washed with 50 μl of the 50 mM borate buffer (pH 8.3) after each centrifugation. This step allowed the unbound aptamers and excess EDC to get eliminated from the sensor solution.

Table 1 Summary of three different concentrations of DSS peptide added during synthesis of the sensor–peptide conjugate.

Synthesis of DSS peptide conjugated molecular beacon using TNF-α binding aptamer

The synthesis protocol of the DSS conjugated molecular beacon with the TNF-α binding aptamer is based on the protocol reported by Ghosh et al.1. Briefly, 9 μl of TCEP was added to 20 μl of the 100 μM TNF-α aptamer and the mixture was allowed to incubate for 30 min at room temperature. 100 μl of gold nanoparticle (diameter: 1.4 nm; Nanoprobes, USA) solution was synthesized by adding the same volume of de-ionized water to one vial of gold nanoparticles. This was further added to the aptamer-TCEP mixture in order to achieve a 3:1 ratio between the quencher and the DNA aptamer. The resulting solution was then incubated for 2 h at room temperature. Subsequently, it was centrifuged twice at 5,000 rpm for 15 min each using a 3 k MWCO filter in order to remove the excess unbound gold nanoparticles from the solution. After each centrifugation, 50 μl of de-ionized water was used to wash the supernatant. The centrifuge used for all centrifugation steps was the Fisher Scientific Accuspin micro (Fisher Scientific, USA). A 100 μl QD (diameter: 20 nm; Thermo Fisher Scientific, USA) solution was synthesized by mixing 87 μl of 10 mM borate buffer (pH 7.4) and 13 μl of carboxylated CdSe/ZnS QD. 2.3 mg of the DSS peptide was added to 230 μl of de-ionized water in order to make a 10 mg/ml peptide solution. EDC/NHS coupling chemistry was used to bind the QDs to the DNA aptamer as well as to bind the DSS peptide to the QD. 100 μl of the QD solution and 230 μl of the DSS peptide was added to the filtered TNF-α aptamer/gold nanoparticle solution in the presence of 30 μl of 4 μg/μl EDC/Sulpho NHS solution. The resulting solution was then allowed to shake for 2 h at room temperature. Subsequently, the samples were centrifuged five times at 7,000 rpm for 5 min each using a 100 k MWCO filter in 50 mM borate buffer (pH 8.3). The supernatant was washed with 50 μl of the 50 mM borate buffer (pH 8.3) after each centrifugation. This step allowed the unbound aptamers and excess EDC to get eliminated from the sensor solution.

Characterization of DSS peptide structure

The DSS peptide was characterized using Raman spectroscopy. 5 μl of the DSS peptide was allowed to dry on a stainless steel Raman substrate. Raman measurements were performed with a Renishaw inVia Reflex Raman spectrometer using 532 nm HeNe laser excitation (17.5 mW laser power output) with 1% laser power, long working distance 50 × objective (8.2 mm WD), 10 s exposure time and 3 accumulations for each run.

Testing DSS peptide conjugated molecular beacons with PBS based TNF-α samples

Sensitivity characterization

The TNF-α solutions were prepared by diluting the 10 μg/ml in PBS. 5 μl of these solutions were added to the 750 μl sensor solution. The sensor–target mixture was then allowed to incubate for an hour. The photoluminescence intensities were obtained using a USB4000 Ocean Optics (Dunedin, FL, USA) spectrophotometer with a continuous 375 nm LED excitation.

Specificity characterization

The DSS conjugated molecular beacons were tested using control proteins such as GA, vascular endothelial growth factor (VEGF), C-reactive protein (CRP), and Thrombin. The control protein solutions were prepared in PBS. All the proteins were kept at a concentration of 65 nM or above except TNF-α, which was kept at 17 nM. 5 μl of these solutions were added to the 750 μl sensor solution. The sensor–protein mixture were then allowed to incubate for an hour. The photoluminescence intensities were obtained using a USB4000 Ocean Optics (Dunedin, FL, USA) spectrophotometer with a continuous 375 nm LED excitation.

Testing DSS peptide conjugated molecular beacons with cells

For GA detecting molecular beacons

Mouse pre-osteocyte cells (MC3T3 E1) were cultured in α-MEM with 10% FBS and 1% Antibiotic–Antimycotic (100×, Life technologies) at 37 °C in a humidified incubator with 5% CO2. The 250,000 cells were seeded on a ϕ 25 mm cover glass in a well of 6 well culture plate. The next day the DSS conjugated GA detecting aptasensors were added to interact with the cells.

For TNF-α detecting molecular beacons

Mouse monocyte/macrophage cells (RAW264.7) were a kind gift from Dr. Afsar Naqvi (University of Illinois at Chicago) and were cultured in DMEM with 10% FBS and 1% Antibiotic–Antimycotic at 37 °C in a humidified incubator with 5% CO2. The 100,000 cells were seeded on a ϕ 12 mm cover glass in a well of 24 well culture plate. The cells were then stimulated/differentiated by lipopolysaccharides (100 ng/ml in RPMI media—Escherichia coli O26:B6–BSL 2, Invitrogen) in the same culture media for 4 h. Subsequently, the DSS conjugated TNF-α detecting aptasensors were added to interact with the cells.

After addition of QDs, the reactions were stopped briefly rinsed with PBS twice, subsequently the cells were fixed with 10% formalin (PBS neutralized) at 37 °C for 1 h. After washing with PBS for 3 times, the cover glass was mounted on a glass slide with mounting agent with DAPI (VectorLab). The QD fluorescence signals were observed with a Zeiss LSM 710 Confocal Microscope in Research Resources Center of University of Illinois at Chicago or with a Zeiss Observer D1 Microscope.

The QD fluorescence images were processed using MATLAB R2019a to obtain the filtered images of the quantum dot emissions. These filtered were further processed using Image J software to obtain the total fluorescence intensities and mean gray values.



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *